viennarna-structure-prediction

Community

Predict RNA secondary structures.

Authorjaechang-hits
Version1.0.0
Installs0

System Documentation

What problem does it solve?

This Skill automates the prediction of RNA secondary structures, minimum free energy (MFE) folding, and base pair probabilities, crucial for understanding RNA function and interactions.

Core Features & Use Cases

  • MFE Folding: Predicts the most stable 2D structure of an RNA sequence.
  • Partition Function: Calculates ensemble-level base pair probabilities to assess structural uncertainty.
  • RNA-RNA Duplex Prediction: Models interactions between two RNA molecules.
  • Use Case: Design a siRNA by predicting the secondary structure of a target mRNA region to identify accessible sites for binding.

Quick Start

Use the viennarna-structure-prediction skill to predict the MFE structure for the RNA sequence 'GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA'.

Dependency Matrix

Required Modules

ViennaRNAmatplotlibnumpypandas

Components

scriptsreferencesassets

💻 Claude Code Installation

Recommended: Let Claude install automatically. Simply copy and paste the text below to Claude Code.

Please help me install this Skill:
Name: viennarna-structure-prediction
Download link: https://github.com/jaechang-hits/SciAgent-Skills/archive/main.zip#viennarna-structure-prediction

Please download this .zip file, extract it, and install it in the .claude/skills/ directory.
View Source Repository

Agent Skills Search Helper

Install a tiny helper to your Agent, search and equip skill from 223,000+ vetted skills library on demand.