viennarna-structure-prediction

What problem does it solve?

This Skill automates the prediction of RNA secondary structures, minimum free energy (MFE) folding, and base pair probabilities, crucial for understanding RNA function and interactions.

Core Features & Use Cases

• MFE Folding: Predicts the most stable 2D structure of an RNA sequence.
• Partition Function: Calculates ensemble-level base pair probabilities to assess structural uncertainty.
• RNA-RNA Duplex Prediction: Models interactions between two RNA molecules.
• Use Case: Design a siRNA by predicting the secondary structure of a target mRNA region to identify accessible sites for binding.

Quick Start

Use the viennarna-structure-prediction skill to predict the MFE structure for the RNA sequence 'GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA'.